Review



str dna sequencing  (IDEXX)


Bioz Verified Symbol IDEXX is a verified supplier
Bioz Manufacturer Symbol IDEXX manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    IDEXX str dna sequencing
    Str Dna Sequencing, supplied by IDEXX, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/str dna sequencing/product/IDEXX
    Average 90 stars, based on 1 article reviews
    str dna sequencing - by Bioz Stars, 2026-04
    90/100 stars

    Images



    Similar Products

    short tandem repeat (str) dna sequencing  (Institut Curie)
    90
    Institut Curie short tandem repeat (str) dna sequencing
    Short Tandem Repeat (Str) Dna Sequencing, supplied by Institut Curie, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/short tandem repeat (str) dna sequencing/product/Institut Curie
    Average 90 stars, based on 1 article reviews
    short tandem repeat (str) dna sequencing - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    str dna sequencing  (IDEXX)
    90
    IDEXX str dna sequencing
    Str Dna Sequencing, supplied by IDEXX, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/str dna sequencing/product/IDEXX
    Average 90 stars, based on 1 article reviews
    str dna sequencing - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer)  (Sangon Biotech)
    90
    Sangon Biotech str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer)
    Str Binding Single Stranded Dna (Str1 Aptamer Sequence: 50 Tagggaattcgtcgacggatccggggtctggtgttctgctttg Ttctgtcgggtcgtctgcaggtcgacgcatgcgccg 30, 79 Mer), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer)/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer) - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier

    Image Search Results